circad | circRNAs associated with diseases

circPTGR1
Gene	PTGR1	Organism	Human
Genome Locus		Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink		PMID	30630697
Experimental Method
Sample Type	Tissue and cell lines	Comparison	82 HCC patients and 47 healthy people
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAAGCACTTTGTTGGCTATCCTAC Reverse TGCCCCATCATTGTATCACCT	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Wang, G, Liu, W, Zou, Y, Wang, G, Deng, Y, Luo, J, Zhang, Y, Li, H, Zhang, Q, Yang, Y, Chen, G (2019). Three isoforms of exosomal circPTGR1 promote hepatocellular carcinoma metastasis via the miR449a-MET pathway. EBioMedicine, 40:432-445.